Leishmania major: serine/threonine protein phosphatase, putative
Week 13 & 14 Virtual Screening
Figure 37. A shows 2-D model of compound 71719976. It is the highest scoring control compound. Figure B represents compound 71719976 in the active site of LmajSTPP. Figure C represents 2-D model of compound 71720391. It is the lowest scoring negative control compound. Figure D represents compound 71720391 in the active site of LmajSTPP. Figure E shows 2-D model of compound 7923489. It is the highest scoring compound from both CB 306 and InHouse Compounds library runs. Figure D represents compound 7923489 in the active site of LmajSTPP. In figures B, D, and F, the residues on LmajSTPP 5 Angstroms around the substrate are shown in green lines and sticks. The lines represent the non-hydrophobic residues and the green sticks represent the hydrophobic residues. On the LmajSTPP, carbon is green, nitrogen is blue, oxygen is red, and hydrogens are gray. In figures B and D, the cyan sticks represent the positive and negative control ligands with carbon as cyan, nitrogen as blue, oxygen as red, and hydrogen as gray. In figure F, the ligand is represented in magenta sticks with carbon as magenta, nitrogen as blue, oxygen as red, and hydrogen as gray. Polar contacts are shown in black dashes. Hydrophobic residues are labeled in the active site.
Analysis: From figure 21 B and D, it can be seen that the highest and the lowest scoring compound are both very large and that only parts of the compound could fit into the active site. However, it can be seen that the compound in D protrudes more out of the active site than does the compound in A. In figure 21 F, it can be seen that the highest scoring ligand, 7923489, can be seen fitting in the middle of the hydrophobic residues.
Figure 36. Results of the top 10 ligands from docking runs of CB 306 library and InHouse Compounds using Autoscale = 2. Blue rows represent compounds from from CB 306 library and white rows represent compounds from InHouse Compounds library. Scores, ligand name, molecular weight, LogP, H-Bond Donors, H-Bond Acceptors, and whether the ligand satisfied Lipiski’s Rule of 5 are listed.
Analysis: In table 2, it can be seen that all of the compounds satisfied Lipinski’s rule of 5 and that most of the high scoring compounds are from InHouse Compounds. The highest score was only 71.37, which was not very high.
Figure 35. Results of docking using 11 predicted positive control ligands and 6 predicted negative ligands. Green rows represent predicted positive controls and orange represent predicted negative controls. Scores, ligand name, molecular weight, LogP, H-Bond Donors, H-Bond Acceptors, and whether the ligand satisfied Lipiski’s Rule of 5 are listed. Autoscale was 2.
Analysis: Table 1 shows the control docking runs from gathered control ligands from Binding Database. It can be seen that predicted positive ligands dominate the high scoring ligands except for the highest one. This is because the positive control ligands is only a prediction based of off other studies on similar enzymes. As a result, it is acceptable for a predicted negative control ligand to score higher than predicted positive ligands. Only few of the control ligands satisfied Lipinski’s rule of 5. Although the highest score was only 75.6, there is great range between the lowest score and the highest score.
Enzyme Assay and Inhibition Assay
Figure 34. Inhibition assay of YopH purified using NTA-Ni affinity matrix. Absorbance is the absorbance minus the control without YopH. This results in an absorbance of 0 in the first sample. First bar was a control with 0.100 mM of inhibitor, but no enzymes. Second and third bars contained 1.2 nM of YopH and no inhibitors. Rest of bars contained 1.2 nM of YopH with inhibitor concentrations on the x-axis. The last bar was a positive control, containing 0.001 mM of Orthovanadate . n = 2 and the average of the two runs are shown. Error bars represent the difference in absorbance between two runs. The absorbance was measured at 410 nm with a Vernier Visible Spec.
Analysis: From figure 34, it can be concluded that the inhibition assay is inclusive and unreliable due to the large error bars, poor inhibition activity, and poor inhibition activity from the positive control, Orthovanadate. The large error bars could be caused by a changing in inhibitors between compound 5852635 and compound 5250098. This is because when a new tube of inhibitors was used for Run 2 because the initial tube of 5852635 ran out, a different compound, 5250098, might have been used because it was not known that there were more than one inhibitor in the box. As a result, the absorbance did not decrease as the inhibitor concentration increased. The absorbance readings plotted are the absorbance of the trial minus that of the control with no enzymes. This means that a true inhibitor will have absorbance as negative on the graph because it shows that there are less products absorbed then that of with no enzyme. However, it seems that the only sample where there is negative absorbance is on one of the controls that did not contain any inhibitors at all. All other samples with inhibitors, including the positive control, showed that there seems to be an increase in p-Nitrophenol produced, not a decrease. A source of error for the inconsistent data could also be that an FLPC was not conducted and that YopH was not concentrated.
Figure 33. Enzyme assay of YopH with varying concentration of YopH and 0.5 mM pNPP. Absorbance is the absorbance minus the control without YopH. Vertical standard error bars (negligible) represent the standard deviation between two readings. The absorbance was measured at 410 nm with a Vernier Visible Spec.
Analysis: Figure demonstrates an increase in p-Nitrophenylene anion, which is a product of YopH phosphatase. It can be concluded from the enzyme assay data that when no YopH is present, no p-Nitrophenol is produced and that as the concentration of YopH is increased, the production of p-Nitrophenol is increased until it approaches a production limit. In sum, successful enzyme assay.
Protein expression, purification, characterization
Figure 32. SDS-PAGE gel of purification of YopH. Lane 1 (sample 0) is cell lysate before induction, lane 2 (sample 1) is cell lysate after induction, lane 3 (sample 2) is soluble fraction, lane 4 (sample 3) is the flow through, lane 5 (sample 4) is the wash, lane 6 (sample 5) is elution 1, lane 7 (sample 6) is elution 2. Ladder used was PageRuler Prestained Protein Ladder #SM0671.
Analysis: A successful induction of YopH can be seen in lane 2 at 35 kDa. A distinct band at 35 kDa demonstrates the expression of YopH. The from lane 3, it can be seen that YopH was collected in the soluble fraction, and then successfully collected in elution 1 and 2 with little contamination. In sum, successful purification.
Figure 31. SDS-PAGE gel of purification of LmajSTPP. Lane 1 (sample 0) is cell lysate before induction, lane 2 (sample 1) is cell lysate after induction, lane 3 (sample 2) is soluble fraction, lane 4 (sample 3) is the flow through, lane 5 (sample 4) is the wash, lane 6 (sample 5) is elution 1, lane 7 (sample 6) is elution 2. Ladder used was PageRuler Prestained Protein Ladder #SM0671.
Analysis: It can be seen that the characterization gel of LmajSTPP was not very successful. The ladder was very faint and that there were little proteins in lane 2, which contained the cell lysate after induction. This means that there were little proteins being expressed and that induction was not successful. The flow through and wash samples looked correct, however, there were contamination of proteins of many sizes in both elution 1 and 2. An explanation for this could be that Bl21(DE3) was not expressing LmajSTPP at all. Therefore, there were no selectivity in eluting the proteins because there were little LmajSTPP with the HIS tag produced in the first place. It is also difficult to locate LmajSTPP, 35 kDa, in the elution lanes because of the loss of selectivity in the elution step, there could be other proteins in the expression cell that had proteins of around 35 kDa. In conclusion, unsuccessful expression and purification.
Week 11 & 12 Protein Purification
Figure 30. Absorbance of LmajSTPP read at 280 nm after purification.
Analysis: Average absorbance is 0.146 @ 280 nm. Molar Extinction Coefficient is 44975 assuming all pairs of Cys residues form cystines and 44350 assuming all Cys residues are reduced. The Molecualr Weight of the protein is 35860.6 Dalton.
Figure 29. Nanodrop of LmajSTPP after protein purification. Absorbance read at 280 nm.
Analysis: Average absorbance @ 280 nm from Elution 1 is 0.4225.
Protein Expression
LmajSTPP was expressed through Option A protein expression protocol with the overnight induction step. OD-600 nm was 0.7 when IPTG was added.
Analysis: Although the OD-600 nm was 0.1 at the start of incubation, the OD dropped in the first hour. Because of the drop, Red Tide was used to double check the absorbance. When the OD was measured with Red Tide, the OD-600 nm was much larger than that from Chipper. Red Tide was used for the rest of growth step. IPTG was added at OD-600nm = 0.7.
Option 1 lysing was conducted. Lysing buffer contained 100mM of Tris instead of 50 mM of Tris.
Week 9 & 10 PCR Clean-up and Nanodrop
Figure 27. Nanodrop of PCR Clean up of PCR^2 (Trial1).
Figure 28. Nanodrop of PCR Clean up of PCR^2 (Trial2).
Analysis: The average concentration is 61.1 ng/uL. The 260/280 in both trials are close1.8, which means that there is little protein contamination in the sample. The 260/230 is close to 2.1, which means that there is little contamination of carbohydrates and phenols. The nanodrop reading shows a high concentration of DNA in the sample, it does not necessarily mean that it is the LmajSCPP insert because as can be seen in figure 26, the LmajSCPP band is very weak. As a result, the majority of the products may be primer dimers.
Conclusion/Forward: There is a high concentration in sample despite the low visibility of LmajSCPP on the gel electrophoresis. It is unclear whether the product will be a good candidate for transformation. Talk to Dr. B.
PCR^2
Analysis: A new primer work solution was prepared and used in this PCR^2. The is still very large primer dimers from 100bp to 200 bp. There is a very faint band at 1 kb where LmajSCPP is supposed to be. This is very strange because there was still LmajSCPP band in the PCR^2 before this one. Sources of error could be not using enough PCR^2 products to run the gel or the template was damaged in the gel extraction by the UV.
Conclusion: PCR^2 amplification of the gel extraction products was unsuccessful.
Gel Extraction and Nanodrop
Figure 24. Nanodrop of LmajSCPP after PCR^2 and Gel extraction (Trial 1).
Figure 25. Nanodrop of LmajSCPP after PCR^2 and Gel extraction (Trial 2)
Analysis: The average concentration of LmajSCPP is 27.9 ng/uL. The 260/280 in both trials are higher than 1.8, which means that there is protein contamination in the sample. The 260/230 is significantly less than 2.1, which means that there is contamination of carbohydrates and phenols. The reason that there is significantly higher contamination in the products is that there is much more contaminants to start with, such as the pieces of the agarose gel.
Conclusion/Forward: Because the concentration of LmajSCPP with eight 50 uL tubes is still too low for transformation, the gel extracted products will be amplified through another around of PCR^2.
PCR^2
I forgot to take a picture of the PCR^2 gel before cutting out the bands for gel extraction. The gel looked like a PCR^2 gel from before, except the primer dimer bands were very strong and the LmajSCPP band was very weak. 8 tubes of 50 uL PCR^2 products were ran on a 6-well gel.
PCR Clean up and Nanodrop
Figure 22. Nanodrop of pNIC-Bsa4 after digestion by Bsa-HF and PCR clean up. (Trial 1)
Figure 23. Nanodrop of pNIC-Bsa4 after digestion by Bsa-HF and PCR clean up. (Trial 2)
Analysis: Concentrations of cut pNIC-Bsa4 was still relatively high after PCR Clean-up. The average concentration of cut pNIC-Bsa4 is 42.25 ng/uL. The 260/280 in both trials are close to 1.8, which means that there is little protein contamination in the sample. The 260/230 is greater than 2.1, which means that there is be contamination of carbohydrates and phenols.
Conclusion: The PCR Clean up was successful in that there was little loss of pNIC-Bsa4.
Cut pNIC-Bsa4 with BsaI-HF and Secondary PCR
Figure 21. 1% agarose gel with ethidium bromide of digestion of pNIC-Bsa4 by BsaI-HF in lane 1 and secondary PCR in lane 2.
Analysis: Lane 1 contains a band a 6 kb and another at 2 kb, which represents the accepting vector of pNIC-Bsa4 and the SacB gene respectfully. There is a strong band at 1 kb in lane 2, demonstrating the amplification of LmajSCPP gene.
Conclusion/Forward:Digestion of pNIC-Bsa4 by BsaI-HF and Secondary PCR was successful. The accepting vector is now ready for transformation. PCR^2 and gel extraction will be conducted to prepare for the PCR insert.
Cloning Trial 2
Figure 19. DH5α cells transformed with pNIC-Bsa4 and LmajSCPP gene insert grown on agarose plate with kanamycin and surcose. pNIC-Bsa4: 2 ul/lmajSCPP: 8 ul.
Figure 20. DH5α cells transformed with pNIC-Bsa4 and LmajSCPP gene insert grown on agarose plate with kanamycin and surcose. pNIC-Bsa4(From Grant): 2 ul/lmajSCPP: 4 ul.
Figure 18. DH5α cells transformed with pNIC-Bsa4 and LmajSCPP gene insert grown on agarose plate with kanamycin and surcose. pNIC-Bsa4: 2 ul/lmajSCPP: 4 ul.
Analysis: No colonies were found on three plates that were transformed. An additional transformation was conducted this time using Grant's accepting vector because he was conducting cohesive end generation and transformation with me. The picture were taken after 48 hours of incubation.
Conclusion/Forward: pNIC-Bsa4 with LmajSCPP was unsuccessfully cloned again and a third attempt will be made. New pNIC-Bsa4 will need to be cut and gel extraction will be conducted on the PCR^2 products to prevent the presence of primer dimers in transformation. More secondary PCR must be made before PCR^2.
Cloning Trial 1
Figure 17. DH5α cells transformed with pNIC-Bsa4 and LmajSCPP gene insert grown on agarose plate with kanamycin and surcose. pNIC-Bsa4: 2 ul/lmajSCPP: 4 ul.
Figure 16. DH5α cells transformed with pNIC-Bsa4 and LmajSCPP gene insert grown on agarose plate with kanamycin and surcose. pNIC-Bsa4: 2 ul/lmajSCPP: 8 ul.
Analysis: Pictures were taken after 48 hours of incubation. After the first 24 hours, there was nothing on the plates. However, after 48 hours, abnormal colonies were discovered on the plates. It is not know whether the yellow spots and gray spots are true clones. Other people who used the same plates for transformation also experienced similar results.
Conclusion/Forward: pNIC-Bsa4 with LmajSCPP was unsuccessfully transformed into DH5α cells. A second cloning attempt will be conducted.
Week 7 & 8 Cut pNIC-Bsa4 with BsaI-HF
Figure 15. 1% agarose gel of pNIC-Bsa4 cut by Bsa1-HF in lane 1.
Analysis: There is a distinct band at 5 kb, which is the length of pNIC-Bsa4 with the SacB gene removed. The band is darker than the SacB band, which confirms that more ethidium bromide is bound to it than SacB gene due to its longer length. The more ethidium bromide thus generated a stronger fluorescent under UV. The lower band in lane 1 at 2 kb should be the SacB gene that is cut out by BsaI-HF. The true length of SacB gene matches with the band location on the gel. There is also excellent separation of the ladder in the gel.
Conclusion: SacB gene is successfully cut out of pNIC-Bsa4 by BsaI-HF.
Next Step: Cohesive end generation, annealing and transformation into competent DH5alpha cells.
Grew up pNIC-Bsa4 in LB media from Anita's plates that already have pNIC-Bsa4 colonies. Midiprep was then performed to purify the DNA. The DNA concentration was then measured by Nanodrop.
Figure 14. Trial one and two of nanodrop readings of purified DNA from grown pNIC-Bsa4 colonies
Analysis: Clear and distinct peaks can be seen from figure 14, which means that there is little contamination in the purified DNA sample. The 260/280 in both trials are close to 1.8, which means that there is little protein contamination in the sample. The 260/230 is greater than 2.1, which means that there may be contamination of carbohydrates and phenols. The average concentration is 42 ng/uL, which is lower than what is desired for ligation and transformation.
Conclusion/Forward: Acceptable pNIC-Bsa4 concentration from DH5alpha cells. Ready for digestion to cut out SacB gene.
PCR Clean up of both PCR^2 products followed by Nanodrop.
Figure 13. Nanodrop of PCR clean up of the combined PCR^2 products from both PCR^2 trials.
Analysis: A good peak can be seen from figure 13. The 260/280 in both trials are close to 1.8, which means that there is little protein contamination in the sample. The 260/230 is also close to 2.1, which means that there is little contamination of carbohydrates and phenols. 149.9 ng/uL is a good concentration for ligation and transformation.
Conclusion/Forward: Good concentration and low contamination of LMajSTPP gene that is now ready for ligation and transformation.
Week 5 & 6 PCR Squared (Trial 2)
Figure 12. 1% agarose gel of PCR^2 products using secondary PCR as template. The PCR^2 product was ran across wells 1-4.
Analysis: PCR^2 was conducted again hoping to reduced the band at 100 bp by reducing the forward and reverse primer concentration from 20 mM to 15 mM. Unfortunately, the band can still be seen in this picture. It can be distinguished that the length is actually smaller than 100 bp. The template from Secondary PCR was successfully amplified as can be seen in the band at 1000 bp.
Next Step: Carry out transformation utilizing the PCR^2 products from both trials. In addition, another PCR^2 will be conducted and a gel extraction will be performed to exclude the contaminant. pNIC cultures will also be started.
PCR Squared (Trial 1)
Figure 11. 1% agarose gel of PCR^2 in wells 1-4.
Analysis: A PCR^2 was conducted utilizing the secondary PCR products that used tail primers. The PCR^2 products were then divided among 4 wells to run on. It can be distinguished that although a strong band can be seen at 1000 bp (LmajSTPP), another faint band can be seen across all 4 wells at 100 bp. This PCR^2 was conducted using 20 mM of forward and reverse primers. This band could be caused by primer dimerization or DNA contamination. Secondary PCR redo
Figure 10. 1% agarose gel of secondary PCR with tail primers in lane 1.
Analysis: Secondary PCR utilizing the tail primers was re-preformed because there was a mix up in storage where the secondary PCR with the oligo's tails and the tail primers could not be distinguished. A new secondary PCR had to be re-done to ensure that the template for PCR^2 is the correct template. As can be seen in figure 10, that a clear band can be seen at around 1000 bp, which is the length of the LmajSTPP. The template was successfully carefully marked and stored in the -20 Celsius freezer. .
Week 3 & 4 Primary and Secondary PCR
Figure 9. 1% agarose gel secondary PCR products of L.majSTPP gene using tail primers. Lane 1 was for another study. Lane 2 is the secondary PCR product of LmajSTPP gene.
Analysis: The single band at 1000 bp verifies the success of the Secondary PCR because it demonstrates that the product is predominantly the LmajSTPP gene (~1000bp).
Conclusion: The LmajSTPP has been successfully constructed through Primary PCR and amplified by Secondary PCR.
Figure 8. 1% agarose gel of primary PCR product of L. maj STPP gene and secondary PCR product with 1st and last oligo primers. Lane 1 contained the primary PCR product and lane 2 contained the secondary PCR product.
Analysis: The smear from lane 1 represents a successful primary PCR because the large range of DNA includes the oligos that did not extend successfully, to those that were extended beyond length of the length of the gene, which is only around 1000 bp. Lane 2 verifies that the gene amplified is the same length as its true length.
Practice Digestion of pGBR-22
Figure 7. 1% agarose gel of restriction endonuclease digest of pGBR-22 with BsaI and PvuII. Lane 1 is uncut plasmid, lane 2 is cut by BsaI, lane 3 is cut by PvuII, lane 4 is cut by BsaI and PvuII.
Figure 6. Virtual gel from NEB Cutters of pGBR-22 cut by BsaI and PvuII.
Analysis: Although correct running buffer was used, BsaI was used instead of EcoRI. Interestingly, only 2 bands resulted when digested by both BsaI and PvuII although the first two independent digestions by BsaI and PvuII seemed to show that there are 3 restriction sites. Upon closer investigation, it was found that when the pGBR-22 plasmid was cut by both BsaI and PvuII, two of the fragments are of nearly equal length, thus resulting only 2 bands. Note how the band of the uncut plasmid traveled further than the one cut by BsaI, even though they are the same number of base pairs. This is because when the plasmid is uncut, the plasmid remains in its super-coiled form, which allows it to migrate through the gel with more ease than a cut plasmid.
Figure 5. 1% Agarose gel in TBE of restriction endonuclease digestion of pGB-22 plasmid using EcoRI and PvuII. Lane 1 is uncut plasmid, lane 2 is cut by EcoRI, lane 3 is cut by PvuII, lane 4 is cut by EcoRI and PvuII.
Figure 4. Virtual gel from NEB Cutters of a custom digested pGBR-22 plasmid using EcoRI and PvuII.
Analysis: Although the bands from Figure 5 appeared as predicted from the virtual in Figure 4, the gel results were poor in quality because it was ran in TBE instead of TAE. Therefore, another RE digestion was conducted. Because pGBR-22 plasmid only has one restriction site for EcoRI, this yielded only one band because the length of plasmid did not change. Only 2 restriction sites for PvuII resulted in 2 bands on the agarose gel. When digested by both restriction endonucleases, 3 bands resulted the 3 restriction sites yielded 3 fragments of different lengths.
Conclusion: 2 successful digestions were performed on pGBR-22, first by EcoRI and PvuII, and then by BsaI and PvuII.
Week 1 & 2 PCR products ran on 1% agarose gel
Figure 3. Gel electrophoresis of pGBR22 PCR products in 1% agarose gel in TAE. Amounts of DNA template for lanes 4 - 7 are 0.3 ng, 3 ng, 30 ng, and 0 ng respectively. Lanes 1-3 and 8 contained were used for another study.
Analysis: The brightness of bands between 4, 5 and 6 does not show an 10x relationship as does their DNA templates, which means that increasing the DNA template by 10 fold does not necessarily increase the product output by 10 fold. Tube contamination can be see in lane 7 since there is not suppose to be a band at all in lane 7. The contaminant is most likely pGBR22 since all 4 bands stopped at equal locations of 1000 bp. It can be concluded that the PCR was successful, but precautions must be taken in the future to prevent contamination.
Nanodrop:
Figure 2. Trial 2 of a practice nanodrop reading of 2 µL of pGBR22 at 230 nm. The concentration is 168.8.
The 260/280 ratio is close to the desired 1.9, which means that there is little protein contamination. The 260/230 ratio is close to the desired 2.1, which means that there are littler other contaminates at 230 nm such as phenolate ion and thiocyanates.
Figure 1. Practice nanodrop reading of 2 µL of pGBR22 at 230 nm. Concentration is 166.2 ng/µL.
The 260/280 ratio is close to the desired 1.9, which means that there is little protein contamination. The 260/230 ratio is close to the desired 2.1, which means that there are littler other contaminates at 230 nm such as phenolate ion and thiocyanates.
Leishmania major: serine/threonine protein phosphatase, putative
Week 13 & 14Virtual Screening
Analysis:
From figure 21 B and D, it can be seen that the highest and the lowest scoring compound are both very large and that only parts of the compound could fit into the active site. However, it can be seen that the compound in D protrudes more out of the active site than does the compound in A. In figure 21 F, it can be seen that the highest scoring ligand, 7923489, can be seen fitting in the middle of the hydrophobic residues.
Analysis:
In table 2, it can be seen that all of the compounds satisfied Lipinski’s rule of 5 and that most of the high scoring compounds are from InHouse Compounds. The highest score was only 71.37, which was not very high.
Analysis:
Table 1 shows the control docking runs from gathered control ligands from Binding Database. It can be seen that predicted positive ligands dominate the high scoring ligands except for the highest one. This is because the positive control ligands is only a prediction based of off other studies on similar enzymes. As a result, it is acceptable for a predicted negative control ligand to score higher than predicted positive ligands. Only few of the control ligands satisfied Lipinski’s rule of 5. Although the highest score was only 75.6, there is great range between the lowest score and the highest score.
Enzyme Assay and Inhibition Assay
Analysis:
From figure 34, it can be concluded that the inhibition assay is inclusive and unreliable due to the large error bars, poor inhibition activity, and poor inhibition activity from the positive control, Orthovanadate. The large error bars could be caused by a changing in inhibitors between compound 5852635 and compound 5250098. This is because when a new tube of inhibitors was used for Run 2 because the initial tube of 5852635 ran out, a different compound, 5250098, might have been used because it was not known that there were more than one inhibitor in the box. As a result, the absorbance did not decrease as the inhibitor concentration increased. The absorbance readings plotted are the absorbance of the trial minus that of the control with no enzymes. This means that a true inhibitor will have absorbance as negative on the graph because it shows that there are less products absorbed then that of with no enzyme. However, it seems that the only sample where there is negative absorbance is on one of the controls that did not contain any inhibitors at all. All other samples with inhibitors, including the positive control, showed that there seems to be an increase in p-Nitrophenol produced, not a decrease. A source of error for the inconsistent data could also be that an FLPC was not conducted and that YopH was not concentrated.
Analysis:
Figure demonstrates an increase in p-Nitrophenylene anion, which is a product of YopH phosphatase. It can be concluded from the enzyme assay data that when no YopH is present, no p-Nitrophenol is produced and that as the concentration of YopH is increased, the production of p-Nitrophenol is increased until it approaches a production limit. In sum, successful enzyme assay.
Protein expression, purification, characterization
Analysis:
A successful induction of YopH can be seen in lane 2 at 35 kDa. A distinct band at 35 kDa demonstrates the expression of YopH. The from lane 3, it can be seen that YopH was collected in the soluble fraction, and then successfully collected in elution 1 and 2 with little contamination. In sum, successful purification.
Analysis:
It can be seen that the characterization gel of LmajSTPP was not very successful. The ladder was very faint and that there were little proteins in lane 2, which contained the cell lysate after induction. This means that there were little proteins being expressed and that induction was not successful. The flow through and wash samples looked correct, however, there were contamination of proteins of many sizes in both elution 1 and 2. An explanation for this could be that Bl21(DE3) was not expressing LmajSTPP at all. Therefore, there were no selectivity in eluting the proteins because there were little LmajSTPP with the HIS tag produced in the first place. It is also difficult to locate LmajSTPP, 35 kDa, in the elution lanes because of the loss of selectivity in the elution step, there could be other proteins in the expression cell that had proteins of around 35 kDa. In conclusion, unsuccessful expression and purification.
Week 11 & 12
Protein Purification
Analysis: Average absorbance is 0.146 @ 280 nm. Molar Extinction Coefficient is 44975 assuming all pairs of Cys residues form cystines and 44350 assuming all Cys residues are reduced. The Molecualr Weight of the protein is 35860.6 Dalton.
Analysis: Average absorbance @ 280 nm from Elution 1 is 0.4225.
Protein Expression
LmajSTPP was expressed through Option A protein expression protocol with the overnight induction step. OD-600 nm was 0.7 when IPTG was added.
Analysis: Although the OD-600 nm was 0.1 at the start of incubation, the OD dropped in the first hour. Because of the drop, Red Tide was used to double check the absorbance. When the OD was measured with Red Tide, the OD-600 nm was much larger than that from Chipper. Red Tide was used for the rest of growth step. IPTG was added at OD-600nm = 0.7.
Option 1 lysing was conducted. Lysing buffer contained 100mM of Tris instead of 50 mM of Tris.
Week 9 & 10
PCR Clean-up and Nanodrop
Analysis: The average concentration is 61.1 ng/uL. The 260/280 in both trials are close1.8, which means that there is little protein contamination in the sample. The 260/230 is close to 2.1, which means that there is little contamination of carbohydrates and phenols. The nanodrop reading shows a high concentration of DNA in the sample, it does not necessarily mean that it is the LmajSCPP insert because as can be seen in figure 26, the LmajSCPP band is very weak. As a result, the majority of the products may be primer dimers.
Conclusion/Forward: There is a high concentration in sample despite the low visibility of LmajSCPP on the gel electrophoresis. It is unclear whether the product will be a good candidate for transformation. Talk to Dr. B.
PCR^2
Analysis: A new primer work solution was prepared and used in this PCR^2. The is still very large primer dimers from 100bp to 200 bp. There is a very faint band at 1 kb where LmajSCPP is supposed to be. This is very strange because there was still LmajSCPP band in the PCR^2 before this one. Sources of error could be not using enough PCR^2 products to run the gel or the template was damaged in the gel extraction by the UV.
Conclusion: PCR^2 amplification of the gel extraction products was unsuccessful.
Gel Extraction and Nanodrop
Analysis: The average concentration of LmajSCPP is 27.9 ng/uL. The 260/280 in both trials are higher than 1.8, which means that there is protein contamination in the sample. The 260/230 is significantly less than 2.1, which means that there is contamination of carbohydrates and phenols. The reason that there is significantly higher contamination in the products is that there is much more contaminants to start with, such as the pieces of the agarose gel.
Conclusion/Forward: Because the concentration of LmajSCPP with eight 50 uL tubes is still too low for transformation, the gel extracted products will be amplified through another around of PCR^2.
PCR^2
I forgot to take a picture of the PCR^2 gel before cutting out the bands for gel extraction. The gel looked like a PCR^2 gel from before, except the primer dimer bands were very strong and the LmajSCPP band was very weak. 8 tubes of 50 uL PCR^2 products were ran on a 6-well gel.
PCR Clean up and Nanodrop
Analysis: Concentrations of cut pNIC-Bsa4 was still relatively high after PCR Clean-up. The average concentration of cut pNIC-Bsa4 is 42.25 ng/uL. The 260/280 in both trials are close to 1.8, which means that there is little protein contamination in the sample. The 260/230 is greater than 2.1, which means that there is be contamination of carbohydrates and phenols.
Conclusion: The PCR Clean up was successful in that there was little loss of pNIC-Bsa4.
Cut pNIC-Bsa4 with BsaI-HF and Secondary PCR
Analysis: Lane 1 contains a band a 6 kb and another at 2 kb, which represents the accepting vector of pNIC-Bsa4 and the SacB gene respectfully. There is a strong band at 1 kb in lane 2, demonstrating the amplification of LmajSCPP gene.
Conclusion/Forward: Digestion of pNIC-Bsa4 by BsaI-HF and Secondary PCR was successful. The accepting vector is now ready for transformation. PCR^2 and gel extraction will be conducted to prepare for the PCR insert.
Cloning Trial 2
Analysis: No colonies were found on three plates that were transformed. An additional transformation was conducted this time using Grant's accepting vector because he was conducting cohesive end generation and transformation with me. The picture were taken after 48 hours of incubation.
Conclusion/Forward: pNIC-Bsa4 with LmajSCPP was unsuccessfully cloned again and a third attempt will be made. New pNIC-Bsa4 will need to be cut and gel extraction will be conducted on the PCR^2 products to prevent the presence of primer dimers in transformation. More secondary PCR must be made before PCR^2.
Cloning Trial 1
Analysis: Pictures were taken after 48 hours of incubation. After the first 24 hours, there was nothing on the plates. However, after 48 hours, abnormal colonies were discovered on the plates. It is not know whether the yellow spots and gray spots are true clones. Other people who used the same plates for transformation also experienced similar results.
Conclusion/Forward: pNIC-Bsa4 with LmajSCPP was unsuccessfully transformed into DH5α cells. A second cloning attempt will be conducted.
Week 7 & 8
Cut pNIC-Bsa4 with BsaI-HF
Analysis: There is a distinct band at 5 kb, which is the length of pNIC-Bsa4 with the SacB gene removed. The band is darker than the SacB band, which confirms that more ethidium bromide is bound to it than SacB gene due to its longer length. The more ethidium bromide thus generated a stronger fluorescent under UV. The lower band in lane 1 at 2 kb should be the SacB gene that is cut out by BsaI-HF. The true length of SacB gene matches with the band location on the gel. There is also excellent separation of the ladder in the gel.
Conclusion: SacB gene is successfully cut out of pNIC-Bsa4 by BsaI-HF.
Next Step: Cohesive end generation, annealing and transformation into competent DH5alpha cells.
Grew up pNIC-Bsa4 in LB media from Anita's plates that already have pNIC-Bsa4 colonies. Midiprep was then performed to purify the DNA. The DNA concentration was then measured by Nanodrop.
Analysis: Clear and distinct peaks can be seen from figure 14, which means that there is little contamination in the purified DNA sample. The 260/280 in both trials are close to 1.8, which means that there is little protein contamination in the sample. The 260/230 is greater than 2.1, which means that there may be contamination of carbohydrates and phenols. The average concentration is 42 ng/uL, which is lower than what is desired for ligation and transformation.
Conclusion/Forward: Acceptable pNIC-Bsa4 concentration from DH5alpha cells. Ready for digestion to cut out SacB gene.
PCR Clean up of both PCR^2 products followed by Nanodrop.
Analysis: A good peak can be seen from figure 13. The 260/280 in both trials are close to 1.8, which means that there is little protein contamination in the sample. The 260/230 is also close to 2.1, which means that there is little contamination of carbohydrates and phenols. 149.9 ng/uL is a good concentration for ligation and transformation.
Conclusion/Forward: Good concentration and low contamination of LMajSTPP gene that is now ready for ligation and transformation.
Week 5 & 6
PCR Squared (Trial 2)
Analysis: PCR^2 was conducted again hoping to reduced the band at 100 bp by reducing the forward and reverse primer concentration from 20 mM to 15 mM. Unfortunately, the band can still be seen in this picture. It can be distinguished that the length is actually smaller than 100 bp. The template from Secondary PCR was successfully amplified as can be seen in the band at 1000 bp.
Next Step: Carry out transformation utilizing the PCR^2 products from both trials. In addition, another PCR^2 will be conducted and a gel extraction will be performed to exclude the contaminant. pNIC cultures will also be started.
PCR Squared (Trial 1)
Analysis: A PCR^2 was conducted utilizing the secondary PCR products that used tail primers. The PCR^2 products were then divided among 4 wells to run on. It can be distinguished that although a strong band can be seen at 1000 bp (LmajSTPP), another faint band can be seen across all 4 wells at 100 bp. This PCR^2 was conducted using 20 mM of forward and reverse primers. This band could be caused by primer dimerization or DNA contamination.
Secondary PCR redo
Analysis: Secondary PCR utilizing the tail primers was re-preformed because there was a mix up in storage where the secondary PCR with the oligo's tails and the tail primers could not be distinguished. A new secondary PCR had to be re-done to ensure that the template for PCR^2 is the correct template. As can be seen in figure 10, that a clear band can be seen at around 1000 bp, which is the length of the LmajSTPP. The template was successfully carefully marked and stored in the -20 Celsius freezer. .
Week 3 & 4
Primary and Secondary PCR
Analysis: The single band at 1000 bp verifies the success of the Secondary PCR because it demonstrates that the product is predominantly the LmajSTPP gene (~1000bp).
Conclusion: The LmajSTPP has been successfully constructed through Primary PCR and amplified by Secondary PCR.
Analysis: The smear from lane 1 represents a successful primary PCR because the large range of DNA includes the oligos that did not extend successfully, to those that were extended beyond length of the length of the gene, which is only around 1000 bp. Lane 2 verifies that the gene amplified is the same length as its true length.
Practice Digestion of pGBR-22
Analysis: Although correct running buffer was used, BsaI was used instead of EcoRI. Interestingly, only 2 bands resulted when digested by both BsaI and PvuII although the first two independent digestions by BsaI and PvuII seemed to show that there are 3 restriction sites. Upon closer investigation, it was found that when the pGBR-22 plasmid was cut by both BsaI and PvuII, two of the fragments are of nearly equal length, thus resulting only 2 bands. Note how the band of the uncut plasmid traveled further than the one cut by BsaI, even though they are the same number of base pairs. This is because when the plasmid is uncut, the plasmid remains in its super-coiled form, which allows it to migrate through the gel with more ease than a cut plasmid.
Analysis: Although the bands from Figure 5 appeared as predicted from the virtual in Figure 4, the gel results were poor in quality because it was ran in TBE instead of TAE. Therefore, another RE digestion was conducted. Because pGBR-22 plasmid only has one restriction site for EcoRI, this yielded only one band because the length of plasmid did not change. Only 2 restriction sites for PvuII resulted in 2 bands on the agarose gel. When digested by both restriction endonucleases, 3 bands resulted the 3 restriction sites yielded 3 fragments of different lengths.
Conclusion: 2 successful digestions were performed on pGBR-22, first by EcoRI and PvuII, and then by BsaI and PvuII.
Week 1 & 2
PCR products ran on 1% agarose gel
Analysis: The brightness of bands between 4, 5 and 6 does not show an 10x relationship as does their DNA templates, which means that increasing the DNA template by 10 fold does not necessarily increase the product output by 10 fold. Tube contamination can be see in lane 7 since there is not suppose to be a band at all in lane 7. The contaminant is most likely pGBR22 since all 4 bands stopped at equal locations of 1000 bp. It can be concluded that the PCR was successful, but precautions must be taken in the future to prevent contamination.
Nanodrop:
The 260/280 ratio is close to the desired 1.9, which means that there is little protein contamination. The 260/230 ratio is close to the desired 2.1, which means that there are littler other contaminates at 230 nm such as phenolate ion and thiocyanates.
The 260/280 ratio is close to the desired 1.9, which means that there is little protein contamination. The 260/230 ratio is close to the desired 2.1, which means that there are littler other contaminates at 230 nm such as phenolate ion and thiocyanates.
Sources: http://www.bio.davidson.edu/projects/gcat/protocols/NanoDrop_tip.pdf
Oligo Primer Design:
1 ATGACCACTGCCGGTGGTGGTTCTGCGGTTG 31
2 CGTAGTTGATCATTTCGTCGAGATCGAGAGCGGAGCTAGAACCAACCGCAGAACCACCAC 60
3 CTCGACGAAATGATCAACTACGTTATCCAGTGCAAGCCGCTGTCTGAGCAGCAGGTTGCG 60
4 TGTTTTCTTTTTCCAGAACTTCTTTAACTTTTTCGCACAGACGCGCAACCTGCTGCTCAG 60
5 AAAGAAGTTCTGGAAAAAGAAAACAACGTTCACGCGGTGCGTGCGCCGGTTACCGTTTGC 60
6 TGAACAGCTCCAGGAGGTCGTGGAACTGACCATGAACGTCACCGCAAACGGTAACCGGCG 60
7 GACCTCCTGGAGCTGTTCAAAATCGGTGGTCTGCCGCCTGATACCAACTACCTCTTTATG 60
8 TTCAACAGAGTAGTAGCCACGGTCAACATAGTCACCCATAAAGAGGTAGTTGGTATCAGG 60
9 CGTGGCTACTACTCTGTTGAAACCGTGACGCTCCTCCTGCTGTACAAACTGCGTTACCCG 60
10 GACGAGATTCGTGGTTGCCACGCAGCAGATGGAGACGCTGCGGGTAACGCAGTTTGTACA 60
11 GGCAACCACGAATCTCGTCAGATCACCCAGGTTTACGGTTTTTACGACGAATGCATCCGT 60
12 GGTCGGTGAAAATGGTCCAAACGTTCGCGCTGCCGTATTTACGGATGCATTCGTCGTAAA 60
13 TGGACCATTTTCACCGACCTGTTCGACTACCTGCCGCTGACCGCGCTGGTTGAAAACGAC 60
14 GGTGTCAACGGTCGGAGACAGACCGCCGTGCAGACAGAAAATGTCGTTTTCAACCAGCGC 60
15 TCTCCGACCGTTGACACCTTCTCTCACATTCGTAACCTGGACCGTGTTCAGGAAGTCCCG 60
16 ATCCGGGTCGGACCAGAGCAGGTCGCACATCGGACCTTCGTGCGGGACTTCCTGAACACG 60
17 TCTGGTCCGACCCGGATGATCGTGATGGCTGGGGTATCTCTCCTCGTGGTGCGGGCTTCA 60
18 TTTGTTGTTGTGGCAGAAGCCCTCGGTAACACCCTGGCCGAACGTGAAGCCCGCACCACG 60
19 GCTTCTGCCACAACAACAAAATCAAAACCATCGCTCGTGCCCACCAACTCGTCATGGATG 60
20 AAGATAGTTACGAGCTGGTCCTGGTGGGTCCAAGAGTAACCATCCATGACGAGTTGGTGG 60
21 GGACCAGCTCGTAACTATCTTCTCTGCCCCGAACTACTGCTATCGTTGCGGTAATCTGGC 60
22 AGAAGCATTTATTCATGTGTTCGTCCAGTTCGAGCAGACCCGCCAGATTACCGCAACGAT 60
23 ACGAACACATGAATAAATGCTTCTTCCAGTTTGACCCTGCTCCGCGTCGCGGCGAGGCTC 60
24 TTAGAGGAAGTAGTCCGGGGTCTTTTTAGAAACCTGAGCCTCGCCGCGAC 50